¡Oferta!

Control de gen sintético para mutación del codón 12 del gen K-RAS

$2,000 +IVA

SKU: 13657 Categories: , Tag:

Plásmido control de amplificación isotérmica LAMP con la región de cobertura de 80-85% de las mutaciones del codón 12 del gen K-RAS para set de primers LAMP-Amunet.

Limpiar

Mapa del vector

Restricción Enzimática

Nombre del gen: KRAS

CATALOGO: yF11246

 RES: PvuII

Secuencia del inserto

AGCGAGCGCGGCGCAGGCACTGAAGGCGGCGGCGGGGCCAGAGGCTCAGCGGCTCCCAGGTGCGGGAGAGAGGCCTGCTGAAAATGACTGAATATAAACTTGTGGTAGTTGGAGCTGATGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGATTCCTACAGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACCCAAATCGGATCCCGGG

Cantidad

20 reacciones