Control de gen sintético para Mycobacterium tuberculosis

$2,500 +IVA

SKU: 68683 Categories: , Tag:

Plásmido control de amplificación isotérmica LAMP con la región del gen 16S RNA ribosomal y del gen IS1611 para set de primers LAMP-Amunet.

Limpiar

Mapa del vector

Restricción Enzimáticaera

Nombre del gen: KRAS

CATALOGO: yF11246

 RES: PvuII

Secuencia del inserto

 CCATGGCCTGGCTCAGGACGAACGCTGGCGGCGTGCTTAACACATGCAAGTCGAACGGAAAGGTCTCTTCGGAGATACTCGAGTGGCGAACGGGTGAGTAACACGTGGGTGATCTGCCCTGCACTTCGGGATAAGCCTGGGAAACTGGGTCTAATACCGGATAGGACCACGGGATGCATGTCTTGTGGTGGAAAGCGCTTTAGCGGTGTGGGATGAGCCGAGCTCCAGACCTCACCTATGTGTCGACCTGGGCAGGGTTCGCCTACGTGGCCTTTGTCACCGACGCCTACGCTCGCAGGATCCTGGGCTGGCGGGTCGCTTCCACGATGGCCACCTCCATGGTCCTCGACGCGATCGAGCAAGCCATCTGGACCCGCCAACAAGAAGGCGTACTCGACCTGAAAGACGTTATCCACCATACGGATAGGGGATCTCAGTACACATCGATCCGGTTCAGCGAGGGGAATTCG

Cantidad

20 reacciones