Control de gen sintético para VPH 16, 18, 33 y 31,45

$2,500 +IVA

SKU: 19421 Categories: , Tag:

Plásmido control de amplificación isotérmica LAMP con la región de virus de papiloma tipo 16, 18, 31, 35 y 45 para set de primers LAMP-Amunet.

Limpiar

Mapa del vector

Restricción Enzimática

Nombre del gen: KRAS

CATALOGO: yF11246

 RES: PvuII

Secuencia del inserto

CCATGGGAACTACTGCCTCTATTCAAAGCAGTGCTTTTTTTCCCACTCCTAGTGGATCAATGGTTACTTCCGAATCTCAGTTATTTAATAAGCCATATTGGCTACAACGTGCACAAGGTCATAATAATGGTATTTGTTGGGGCAATCAGGTATTTGTTACTGTGGTAGATACCACTCGCAGTACTAATATGACTTTATGCACACAAGTAACTAGTGGCGGCCGCGCCATATCTACTTCAGAAACTACATATAAAAATACTAACTTTAAGGAGTACCTACGACATGGGGAGGAATATGATTTACAGTTTATTTTTCAACTGTGCAAAATAACCTTAACTGCAGACGTTATGACATACATACATTCTATGAATTCCACTATTTTGGAGGACTGGAATTTTGGTCTACAACCTCCCCCAGGAGGCACACTAGAAGATACTTATAGGTTTGTAACCCAGGCAAGAGCTCCACTGTGCCTCAATCCTTATATATTAAAGGCACAGGTATGCGTGCTTCACCTGGCAGCTGTGTGTATTCTCCCTCTCCAAGTGGCTCTATTGTTACCTCTGACTCCCAGTTGTTTAATAAACCATATTGGTTACATAAGGCACAGGGTCATAACAATGGTGTTTGCTGGCATAATCAATTATTTGTTACTGTGGTAGATACCACTCCCAGTGAATTCATCGGTCCCTACTGACTTATATATTAAAGGCTCCGGTTCAACAGCTACTTTAGCTAACAGTACATACTTTCCTACACCTAGCGGCTCCATGGTTACTTCAGATGCACAAATTTTTAATAAACCATATTGGATGCAACGTGCTCAGGGACACAATAATGGTATTTGTTGGGGCAATCAGTTATTTGAATTCACAATGGTATTTGTTGGCATAATCAGTTGTTTGTTACTGTAGTGGACACTACCCGCAGTACTAATTTAACATTATGTGCCTCTACACAAAATCCTGTGCCAAGTACATATGACCCTACTAAGTTTAAGCAGTATAGTAGACATGTGGAGGAATATGATTTACAGTTTATTTTTCAGTTGTGCACTATTACTTTAACTGCAGAGGTTATGTCATATATCCCCATGGATCGGATCCCGGGCCCGTCGACTGCAGAGGCC

Cantidad

20 reacciones